Stem-loop sequence bta-mir-2285ao-3

AccessionMI0038187 (change log)
DescriptionBos taurus miR-2285ao-3 stem-loop
Literature search

11 open access papers mention bta-mir-2285ao-3
(15 sentences)

Stem-loop
   ---           uc      u  guaccc 
5'    aaaaaguucgu  ggguuu cu      c
      |||||||||||  |||||| ||       
3'    uuuuucaagca  cccaaa ga      c
   cgg           ga      -  aguacu 
Get sequence
Deep sequencing
61077 reads, 304 reads per million, 77 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence bta-miR-2285ao

Accession MIMAT0046360
Sequence

39 - 

aaacccagacgaacuuuuuggc

 - 60

Get sequence
Deep sequencing318 reads, 36 experiments
Evidence experimental; Illumina [1]

References

1
PMID:27100870 "Comparative Analysis of the miRNome of Bovine Milk Fat, Whey and Cells" Li R, Dudemaine PL, Zhao X, Lei C, Ibeagha-Awemu EM PLoS One. 11:e0154129(2016).