Stem-loop sequence bta-mir-2285ap

AccessionMI0038186 (change log)
DescriptionBos taurus miR-2285ap stem-loop
Literature search

11 open access papers mention bta-mir-2285ap
(15 sentences)

Stem-loop
   --               ------------     uu 
5'   caaaaaguucauuug            aacuu  c
     |||||||||||||||            |||||   
3'   guuuuucaaguaggc            uugaa  c
   cg               ccaaaaacauug     ua 
Get sequence
Deep sequencing
616 reads, 3.03 reads per million, 66 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr3: 88075637-88075696 [-]
intergenic
Database links

Mature sequence bta-miR-2285ap

Accession MIMAT0046362
Sequence

39 - 

aaacccggaugaacuuuuuggc

 - 60

Get sequence
Deep sequencing613 reads, 66 experiments
Evidence experimental; Illumina [1]

References

1
PMID:27100870 "Comparative Analysis of the miRNome of Bovine Milk Fat, Whey and Cells" Li R, Dudemaine PL, Zhao X, Lei C, Ibeagha-Awemu EM PLoS One. 11:e0154129(2016).