Stem-loop sequence bta-mir-2285ao-2

AccessionMI0038185 (change log)
DescriptionBos taurus miR-2285ao-2 stem-loop
Literature search

11 open access papers mention bta-mir-2285ao-2
(15 sentences)

Stem-loop
   --          a     a      a    a 
5'   caaaaaguuc uuugg uuuucc uaag c
     |||||||||| ||||| |||||| |||| g
3'   guuuuucaag agacc aaaagg guuc u
   cg          c     c      -    u 
Get sequence
Deep sequencing
2185 reads, 8.33 reads per million, 60 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr1: 155316728-155316789 [+]
intergenic
Database links

Mature sequence bta-miR-2285ao

Accession MIMAT0046360
Sequence

41 - 

aaacccagacgaacuuuuuggc

 - 62

Get sequence
Deep sequencing318 reads, 36 experiments
Evidence experimental; Illumina [1]

References

1
PMID:27100870 "Comparative Analysis of the miRNome of Bovine Milk Fat, Whey and Cells" Li R, Dudemaine PL, Zhao X, Lei C, Ibeagha-Awemu EM PLoS One. 11:e0154129(2016).