Stem-loop sequence bta-mir-11977

AccessionMI0038183 (change log)
DescriptionBos taurus miR-11977 stem-loop
Stem-loop
   --ugag   ----      u   aaga     a   c 
5'       gcu    ugagac agc    gaggg ggc c
         |||    |||||| |||    ||||| ||| a
3'       cga    acucug ucg    cuccc ccg a
   gaagga   cuug      -   ----     -   u 
Get sequence
Deep sequencing
48142 reads, 319 reads per million, 73 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr18: 62162034-62162098 [-]
intergenic
Database links

Mature sequence bta-miR-11977

Accession MIMAT0046359
Sequence

46 - 

ugucucaguucagcaggaag

 - 65

Get sequence
Deep sequencing48141 reads, 73 experiments
Evidence experimental; Illumina [1]

References

1
PMID:27100870 "Comparative Analysis of the miRNome of Bovine Milk Fat, Whey and Cells" Li R, Dudemaine PL, Zhao X, Lei C, Ibeagha-Awemu EM PLoS One. 11:e0154129(2016).