Stem-loop sequence bta-mir-2285an

AccessionMI0038182 (change log)
DescriptionBos taurus miR-2285an stem-loop
Literature search

11 open access papers mention bta-mir-2285an
(15 sentences)

Stem-loop
   --            g       -   uaac 
5'   aaaaaguucauu ggguuuu cug    a
     |||||||||||| ||||||| |||     
3'   uuuuucaaguaa cccgaaa ggu    u
   ga            g       a   uuuc 
Get sequence
Deep sequencing
307 reads, 0 reads per million, 61 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr17: 56761429-56761487 [-]
intergenic
Database links

Mature sequence bta-miR-2285an

Accession MIMAT0046358
Sequence

38 - 

aaagcccgaaugaacuuuuuag

 - 59

Get sequence
Deep sequencing64 reads, 29 experiments
Evidence experimental; Illumina [1]

References

1
PMID:27100870 "Comparative Analysis of the miRNome of Bovine Milk Fat, Whey and Cells" Li R, Dudemaine PL, Zhao X, Lei C, Ibeagha-Awemu EM PLoS One. 11:e0154129(2016).