Stem-loop sequence bta-mir-2285az

AccessionMI0038179 (change log)
DescriptionBos taurus miR-2285az stem-loop
Literature search

11 open access papers mention bta-mir-2285az
(15 sentences)

Stem-loop
   ---       ug         c       g 
5'    aaaaguu  cuuggguuu ccuguaa a
      |||||||  ||||||||| |||||||  
3'    uuuucaa  gagccuaaa ggauauu u
   ggu       gu         a       g 
Get sequence
Deep sequencing
220 reads, 0 reads per million, 48 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr16: 21205854-21205912 [-]
intergenic
Database links

Mature sequence bta-miR-2285az

Accession MIMAT0046356
Sequence

38 - 

aaaauccgagugaacuuuuugg

 - 59

Get sequence
Deep sequencing173 reads, 47 experiments
Evidence experimental; Illumina [1]

References

1
PMID:27100870 "Comparative Analysis of the miRNome of Bovine Milk Fat, Whey and Cells" Li R, Dudemaine PL, Zhao X, Lei C, Ibeagha-Awemu EM PLoS One. 11:e0154129(2016).