Stem-loop sequence bta-mir-2285ay

AccessionMI0038178 (change log)
DescriptionBos taurus miR-2285ay stem-loop
Literature search

11 open access papers mention bta-mir-2285ay
(15 sentences)

Stem-loop
   --    cc                cauuag 
5'   aaga  uucguucaggguuuuc      a
     ||||  ||||||||||||||||       
3'   uuuu  aaguaagucccaaaag      u
   gg    cc                acauug 
Get sequence
Deep sequencing
120 reads, 0 reads per million, 49 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr16: 80588719-80588778 [+]
intergenic
Database links

Mature sequence bta-miR-2285ay

Accession MIMAT0046355
Sequence

39 - 

aaacccugaaugaaccuuuugg

 - 60

Get sequence
Deep sequencing120 reads, 49 experiments
Evidence experimental; Illumina [1]

References

1
PMID:27100870 "Comparative Analysis of the miRNome of Bovine Milk Fat, Whey and Cells" Li R, Dudemaine PL, Zhao X, Lei C, Ibeagha-Awemu EM PLoS One. 11:e0154129(2016).