Stem-loop sequence bta-mir-11974

AccessionMI0038176 (change log)
DescriptionBos taurus miR-11974 stem-loop
Stem-loop
   --          -gu     g  c   gaag  g 
5'   uguggggggc   gcagg gc ggg    cu u
     ||||||||||   ||||| || |||    || c
3'   acacccccug   cgucc cg ccc    gg a
   cg          ugu     a  a   ---a  a 
Get sequence
Deep sequencing
11 reads, 0 reads per million, 10 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr16: 51943891-51943955 [-]
intergenic
Clustered miRNAs
< 10kb from bta-mir-11974
bta-mir-2896chr16: 51953657-51953713 [+]
bta-mir-11974chr16: 51943891-51943955 [-]
Database links

Mature sequence bta-miR-11974

Accession MIMAT0046353
Sequence

42 - 

agcaccugcugugucccccacagc

 - 65

Get sequence
Deep sequencing11 reads, 10 experiments
Evidence experimental; Illumina [1]

References

1
PMID:27100870 "Comparative Analysis of the miRNome of Bovine Milk Fat, Whey and Cells" Li R, Dudemaine PL, Zhao X, Lei C, Ibeagha-Awemu EM PLoS One. 11:e0154129(2016).