Stem-loop sequence bta-mir-2285ax-3

AccessionMI0038175 (change log)
DescriptionBos taurus miR-2285ax-3 stem-loop
Literature search

11 open access papers mention bta-mir-2285ax-3
(15 sentences)

Stem-loop
   --     -                uguaa 
5'   agaag uucguucagguuuuuc     g
     ||||| ||||||||||||||||     a
3'   uuuuc aaguaaguucaaaagg     c
   gg     c                uaugg 
Get sequence
Deep sequencing
581 reads, 17.6 reads per million, 74 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr10: 101548873-101548930 [-]
intergenic
Database links

Mature sequence bta-miR-2285ax

Accession MIMAT0046350
Sequence

37 - 

aaaacuugaaugaaccuuuugg

 - 58

Get sequence
Deep sequencing356 reads, 50 experiments
Evidence experimental; Illumina [1]

References

1
PMID:27100870 "Comparative Analysis of the miRNome of Bovine Milk Fat, Whey and Cells" Li R, Dudemaine PL, Zhao X, Lei C, Ibeagha-Awemu EM PLoS One. 11:e0154129(2016).