Stem-loop sequence bta-mir-2285ax-2

AccessionMI0038174 (change log)
DescriptionBos taurus miR-2285ax-2 stem-loop
Literature search

11 open access papers mention bta-mir-2285ax-2
(15 sentences)

Stem-loop
   --aaaaaaugu   ug            cc 
5'            guu  aguuuuuccaua  a
              |||  ||||||||||||   
3'            uaa  ucaaaaagguau  u
   gguuuuccaag   gu            uc 
Get sequence
Deep sequencing
135 reads, 0 reads per million, 48 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr2: 97262796-97262855 [-]
intergenic
Database links

Mature sequence bta-miR-2285ax

Accession MIMAT0046350
Sequence

39 - 

aaaacuugaaugaaccuuuugg

 - 60

Get sequence
Deep sequencing356 reads, 50 experiments
Evidence experimental; Illumina [1]

References

1
PMID:27100870 "Comparative Analysis of the miRNome of Bovine Milk Fat, Whey and Cells" Li R, Dudemaine PL, Zhao X, Lei C, Ibeagha-Awemu EM PLoS One. 11:e0154129(2016).