Stem-loop sequence bta-mir-2285aw

AccessionMI0038171 (change log)
DescriptionBos taurus miR-2285aw stem-loop
Literature search

11 open access papers mention bta-mir-2285aw
(15 sentences)

Stem-loop
   -        c   ug      u  uuuaa 
5'  aagaaguu guu  gguuuu cc     g
    |||||||| |||  |||||| ||      
3'  uuuuucaa caa  ccaaaa gg     u
   g        a   gu      -  uaugg 
Get sequence
Deep sequencing
10358 reads, 45.5 reads per million, 66 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr13: 19209401-19209458 [+]
intergenic
Database links

Mature sequence bta-miR-2285aw

Accession MIMAT0046348
Sequence

38 - 

aaaaccugaacaaacuuuuug

 - 58

Get sequence
Deep sequencing3812 reads, 43 experiments
Evidence experimental; Illumina [1]

References

1
PMID:27100870 "Comparative Analysis of the miRNome of Bovine Milk Fat, Whey and Cells" Li R, Dudemaine PL, Zhao X, Lei C, Ibeagha-Awemu EM PLoS One. 11:e0154129(2016).