Stem-loop sequence bta-mir-2285av

AccessionMI0038170 (change log)
DescriptionBos taurus miR-2285av stem-loop
Literature search

11 open access papers mention bta-mir-2285av
(15 sentences)

Stem-loop
   --aaa        c         guuuac 
5'      aguucguu ggguuuuuu      a
        |||||||| |||||||||      g
3'      ucaaguaa cccaaaaag      c
   guuuc        a         aucacu 
Get sequence
Deep sequencing
6693 reads, 22.2 reads per million, 72 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr12: 16589918-16589976 [+]
intergenic
Clustered miRNAs
< 10kb from bta-mir-2285av
bta-mir-2285o-1chr12: 16589906-16589987 [-]
bta-mir-2285avchr12: 16589918-16589976 [+]
Database links

Mature sequence bta-miR-2285av

Accession MIMAT0046347
Sequence

1 - 

aaaaguucguucggguuuuu

 - 20

Get sequence
Deep sequencing6628 reads, 72 experiments
Evidence experimental; Illumina [1]

References

1
PMID:27100870 "Comparative Analysis of the miRNome of Bovine Milk Fat, Whey and Cells" Li R, Dudemaine PL, Zhao X, Lei C, Ibeagha-Awemu EM PLoS One. 11:e0154129(2016).