Stem-loop sequence bta-mir-2285au

AccessionMI0038169 (change log)
DescriptionBos taurus miR-2285au stem-loop
Literature search

11 open access papers mention bta-mir-2285au
(15 sentences)

Stem-loop
   aa                  -   -     
5'   aaaguucguucggguuuu cug agcc 
     |||||||||||||||||| ||| ||| a
3'   uuucaagugaguucaaaa gac uugu 
   --                  a   a     
Get sequence
Deep sequencing
60994 reads, 301 reads per million, 77 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr11: 60802911-60802965 [+]
intergenic
Database links

Mature sequence bta-miR-2285au

Accession MIMAT0046346
Sequence

1 - 

aaaaaguucguucggguuuucu

 - 22

Get sequence
Deep sequencing60968 reads, 77 experiments
Evidence experimental; Illumina [1]

References

1
PMID:27100870 "Comparative Analysis of the miRNome of Bovine Milk Fat, Whey and Cells" Li R, Dudemaine PL, Zhao X, Lei C, Ibeagha-Awemu EM PLoS One. 11:e0154129(2016).