Stem-loop sequence bta-mir-2285at-3

AccessionMI0038167 (change log)
DescriptionBos taurus miR-2285at-3 stem-loop
Literature search

11 open access papers mention bta-mir-2285at-3
(15 sentences)

Stem-loop
   -         a         cu     ac 
5'  aaaaaguuc uucggguuu  cugua  a
    ||||||||| |||||||||  |||||   
3'  uuuuucaag aagcccaaa  gguau  g
   g         g         ag     cg 
Get sequence
Deep sequencing
7771 reads, 23.5 reads per million, 68 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence bta-miR-2285at

Accession MIMAT0046342
Sequence

39 - 

aaaacccgaaggaacuuuuug

 - 59

Get sequence
Deep sequencing164 reads, 20 experiments
Evidence experimental; Illumina [1]

References

1
PMID:27100870 "Comparative Analysis of the miRNome of Bovine Milk Fat, Whey and Cells" Li R, Dudemaine PL, Zhao X, Lei C, Ibeagha-Awemu EM PLoS One. 11:e0154129(2016).