Stem-loop sequence bta-mir-2285at-2

AccessionMI0038166 (change log)
DescriptionBos taurus miR-2285at-2 stem-loop
Literature search

11 open access papers mention bta-mir-2285at-2
(15 sentences)

Stem-loop
   --        a   a         gcucu 
5'   aaaaguuc uuc gguuuuucu     a
     |||||||| ||| |||||||||      
3'   uuuucaag aag ccaaaaagg     u
   gu        g   c         uaauc 
Get sequence
Deep sequencing
522 reads, 18.1 reads per million, 72 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr28: 5355072-5355129 [+]
intergenic
Database links

Mature sequence bta-miR-2285at

Accession MIMAT0046342
Sequence

38 - 

aaaacccgaaggaacuuuuug

 - 58

Get sequence
Deep sequencing164 reads, 20 experiments
Evidence experimental; Illumina [1]

References

1
PMID:27100870 "Comparative Analysis of the miRNome of Bovine Milk Fat, Whey and Cells" Li R, Dudemaine PL, Zhao X, Lei C, Ibeagha-Awemu EM PLoS One. 11:e0154129(2016).