Stem-loop sequence bta-mir-2285as-3

AccessionMI0038163 (change log)
DescriptionBos taurus miR-2285as-3 stem-loop
Literature search

11 open access papers mention bta-mir-2285as-3
(15 sentences)

Stem-loop
   --c            --        cca   c 
5'    aaaaguucauuu  gguuuuuu   uaa a
      ||||||||||||  ||||||||   ||| u
3'    uuuucaaguaag  ccgaaaaa   auu c
   ggu            uc        -cc   u 
Get sequence
Deep sequencing
215 reads, 0 reads per million, 57 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr3: 33566602-33566663 [-]
intergenic
Database links

Mature sequence bta-miR-2285as

Accession MIMAT0046338
Sequence

41 - 

aagcccugaaugaacuuuuugg

 - 62

Get sequence
Deep sequencing619 reads, 58 experiments
Evidence experimental; Illumina [1]

References

1
PMID:27100870 "Comparative Analysis of the miRNome of Bovine Milk Fat, Whey and Cells" Li R, Dudemaine PL, Zhao X, Lei C, Ibeagha-Awemu EM PLoS One. 11:e0154129(2016).