Stem-loop sequence bta-mir-2285as-1

AccessionMI0038161 (change log)
DescriptionBos taurus miR-2285as-1 stem-loop
Literature search

11 open access papers mention bta-mir-2285as-1
(15 sentences)

Stem-loop
   --               au     c    a 
5'   aaaaaguucguucag  cuuuc auau a
     |||||||||||||||  ||||| ||||  
3'   uuuuucaaguaaguc  gaaag uaug u
   gg               cc     a    u 
Get sequence
Deep sequencing
347 reads, 13.6 reads per million, 59 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr10: 28921766-28921825 [-]
intergenic
Database links

Mature sequence bta-miR-2285as

Accession MIMAT0046338
Sequence

39 - 

aagcccugaaugaacuuuuugg

 - 60

Get sequence
Deep sequencing619 reads, 58 experiments
Evidence experimental; Illumina [1]

References

1
PMID:27100870 "Comparative Analysis of the miRNome of Bovine Milk Fat, Whey and Cells" Li R, Dudemaine PL, Zhao X, Lei C, Ibeagha-Awemu EM PLoS One. 11:e0154129(2016).