Stem-loop sequence bta-mir-11971

AccessionMI0038159 (change log)
DescriptionBos taurus miR-11971 stem-loop
Stem-loop
   --         -a    -   -    c 
5'   uucacuuuc  cccc caa uuag u
     |||||||||  |||| ||| ||||  
3'   gagugagag  gggg guu gauc a
   aa         ac    a   c    g 
Get sequence
Deep sequencing
38545 reads, 158 reads per million, 73 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr10: 13039868-13039918 [-]
intergenic
Database links

Mature sequence bta-miR-11971

Accession MIMAT0046336
Sequence

32 - 

ugaggggcagagagugagaa

 - 51

Get sequence
Deep sequencing38544 reads, 73 experiments
Evidence experimental; Illumina [1]

References

1
PMID:27100870 "Comparative Analysis of the miRNome of Bovine Milk Fat, Whey and Cells" Li R, Dudemaine PL, Zhao X, Lei C, Ibeagha-Awemu EM PLoS One. 11:e0154129(2016).