Stem-loop sequence tca-mir-3836g-2

AccessionMI0037640 (change log)
DescriptionTribolium castaneum miR-3836g-2 stem-loop
Stem-loop
       u    ca         c      a  u    uuua 
5' aaug cugu  ggucuaccu ugcuua gu gaua    u
   |||| ||||  ||||||||| |||||| || ||||     
3' uugc gaca  ucagaugga acgggu ca cuau    u
       c    uc         -      -  -    uaau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
Unmapped58: 29269-29345 [+]
intergenic
Clustered miRNAs
< 10kb from tca-mir-3836g-2
tca-mir-3851pUnmapped58: 22963-23023 [+]
tca-mir-3851m-2Unmapped58: 24381-24472 [+]
tca-mir-11618a-5Unmapped58: 24542-24628 [+]
tca-mir-11618b-4Unmapped58: 25826-25920 [+]
tca-mir-3851k-4Unmapped58: 26251-26342 [+]
tca-mir-11617d-3Unmapped58: 27516-27575 [+]
tca-mir-3836jUnmapped58: 27860-27918 [+]
tca-mir-3836g-2Unmapped58: 29269-29345 [+]
tca-mir-11619a-2Unmapped58: 29377-29463 [+]
tca-mir-11617a-4Unmapped58: 29511-29603 [+]
Database links

Mature sequence tca-miR-3836g-5p

Accession MIMAT0045583
Sequence

11 - 

aggucuaccucugcuuaaguugaua

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence tca-miR-3836g-3p

Accession MIMAT0045584
Sequence

48 - 

ucacugggcaagguagacucu

 - 68

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26518483 "MicroRNA evolution, expression, and function during short germband development in Tribolium castaneum" Ninova M, Ronshaugen M, Griffiths-Jones S Genome Res. 26:85-96(2016).