Stem-loop sequence tca-mir-11649

AccessionMI0037462 (change log)
DescriptionTribolium castaneum miR-11649 stem-loop
Stem-loop
   ---   -  g    c    c       auacc 
5'    cgg cc gucg aggc agaaauu     g
      ||| || |||| |||| |||||||      
3'    gcu gg cagu uccg ucuuuag     u
   uuc   u  g    u    -       agagu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG4: 6991684-6991744 [-]
intergenic
Clustered miRNAs
< 10kb from tca-mir-11649
tca-mir-11649ChLG4: 6991684-6991744 [-]
tca-mir-210ChLG4: 6990664-6990739 [-]
Database links

Mature sequence tca-miR-11649-3p

Accession MIMAT0045627
Sequence

38 - 

uuucugccuuugacggguucgcu

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26518483 "MicroRNA evolution, expression, and function during short germband development in Tribolium castaneum" Ninova M, Ronshaugen M, Griffiths-Jones S Genome Res. 26:85-96(2016).