Stem-loop sequence tca-mir-11617d-2

AccessionMI0037459 (change log)
DescriptionTribolium castaneum miR-11617d-2 stem-loop
Stem-loop
   --     g      u         uag  c 
5'   aguug cauggg gguacuaua   au a
     ||||| |||||| |||||||||   ||  
3'   ucaac guaucu ucaugauau   ug u
   au     g      u         uaa  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
Unmapped58: 9815-9874 [-]
intergenic
Clustered miRNAs
< 10kb from tca-mir-11617d-2
tca-mir-3851m-3Unmapped58: 12024-12117 [-]
tca-mir-11618a-3Unmapped58: 11866-11958 [-]
tca-mir-11618b-3Unmapped58: 11468-11562 [-]
tca-mir-3851k-3Unmapped58: 11048-11139 [-]
tca-mir-11617d-2Unmapped58: 9815-9874 [-]
tca-mir-3836g-1Unmapped58: 8038-8128 [-]
tca-mir-11619a-1Unmapped58: 7927-8013 [-]
tca-mir-11617a-3Unmapped58: 7787-7879 [-]
Database links

Mature sequence tca-miR-11617d-5p

Accession MIMAT0045598
Sequence

2 - 

guuggcaugggugguacuaua

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26518483 "MicroRNA evolution, expression, and function during short germband development in Tribolium castaneum" Ninova M, Ronshaugen M, Griffiths-Jones S Genome Res. 26:85-96(2016).