Stem-loop sequence tca-mir-11624b-2

AccessionMI0037448 (change log)
DescriptionTribolium castaneum miR-11624b-2 stem-loop
Stem-loop
   ---     g      c   uu     caauu 
5'    auugg acuuua cau  ucaug     u
      ||||| |||||| |||  |||||     a
3'    uggcu ugaaau gug  aguac     u
   uuu     g      c   -u     uacua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG6: 8929472-8929532 [-]
intergenic
Clustered miRNAs
< 10kb from tca-mir-11624b-2
tca-mir-11624dChLG6: 8930530-8930621 [-]
tca-mir-3851eChLG6: 8930351-8930445 [-]
tca-mir-3851d-2ChLG6: 8930246-8930336 [-]
tca-mir-3858a-2ChLG6: 8930130-8930244 [-]
tca-mir-11624b-2ChLG6: 8929472-8929532 [-]
tca-mir-3851fChLG6: 8929279-8929373 [-]
tca-mir-3851hChLG6: 8929175-8929264 [-]
tca-mir-3858ChLG6: 8929084-8929152 [-]
Database links

Mature sequence tca-miR-11624b-3p

Accession MIMAT0045529
Sequence

39 - 

ugaugugcuaaagugucgguuu

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26518483 "MicroRNA evolution, expression, and function during short germband development in Tribolium castaneum" Ninova M, Ronshaugen M, Griffiths-Jones S Genome Res. 26:85-96(2016).