Stem-loop sequence tca-mir-3851g-3

AccessionMI0037446 (change log)
DescriptionTribolium castaneum miR-3851g-3 stem-loop
Stem-loop
   ----- ug       g g        uaauu 
5'      u  acauggg u guacugug     u
        |  ||||||| | ||||||||      
3'      g  uguaccc a caugauac     u
   gacuc gu       - g        ucagu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG6: 8825859-8825916 [+]
intergenic
Clustered miRNAs
< 10kb from tca-mir-3851g-3
tca-mir-3851d-1ChLG6: 8819480-8819570 [-]
tca-mir-11624b-1ChLG6: 8819743-8819834 [-]
tca-mir-11626bChLG6: 8825341-8825447 [+]
tca-mir-11624cChLG6: 8825488-8825579 [+]
tca-mir-3851cChLG6: 8825723-8825833 [+]
tca-mir-3851g-3ChLG6: 8825859-8825916 [+]
Database links

Mature sequence tca-miR-3851g-3p

Accession MIMAT0045522
Sequence

36 - 

uaguacgacccauguuggcuca

 - 57

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26518483 "MicroRNA evolution, expression, and function during short germband development in Tribolium castaneum" Ninova M, Ronshaugen M, Griffiths-Jones S Genome Res. 26:85-96(2016).