Stem-loop sequence tca-mir-11641

AccessionMI0037444 (change log)
DescriptionTribolium castaneum miR-11641 stem-loop
Stem-loop
   ---     c              c  ucc 
5'    uaaau uuugaucaaagugg cu   a
      ||||| |||||||||||||| ||   a
3'    auuua aggcuaguuucauc ga   u
   uua     a              u  cac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG3: 532740-532797 [+]
intergenic
Database links

Mature sequence tca-miR-11641-5p

Accession MIMAT0045603
Sequence

1 - 

uaaaucuuugaucaaaguggcc

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26518483 "MicroRNA evolution, expression, and function during short germband development in Tribolium castaneum" Ninova M, Ronshaugen M, Griffiths-Jones S Genome Res. 26:85-96(2016).