Stem-loop sequence tca-mir-11617d-1

AccessionMI0037438 (change log)
DescriptionTribolium castaneum miR-11617d-1 stem-loop
Stem-loop
   --     g      u         ua   c 
5'   aguug cauggg gguacuaua  uau a
     ||||| |||||| |||||||||  |||  
3'   ucaac guaucu ucaugauau  aug u
   au     g      u         ua   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG2: 1363611-1363670 [+]
intergenic
Clustered miRNAs
< 10kb from tca-mir-11617d-1
tca-mir-11617cChLG2: 1355378-1355472 [-]
tca-mir-11619dChLG2: 1355663-1355755 [-]
tca-mir-3836c-1ChLG2: 1355772-1355863 [-]
tca-mir-3851n-1ChLG2: 1361328-1361433 [-]
tca-mir-3851k-2ChLG2: 1362341-1362432 [+]
tca-mir-11619bChLG2: 1363053-1363144 [+]
tca-mir-11621ChLG2: 1363442-1363536 [+]
tca-mir-11617d-1ChLG2: 1363611-1363670 [+]
tca-mir-3836aChLG2: 1365524-1365614 [+]
tca-mir-11619a-3ChLG2: 1365639-1365725 [+]
tca-mir-11617a-2ChLG2: 1365773-1365865 [+]
Database links

Mature sequence tca-miR-11617d-5p

Accession MIMAT0045598
Sequence

2 - 

guuggcaugggugguacuaua

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26518483 "MicroRNA evolution, expression, and function during short germband development in Tribolium castaneum" Ninova M, Ronshaugen M, Griffiths-Jones S Genome Res. 26:85-96(2016).