Stem-loop sequence tca-mir-3836h

AccessionMI0037436 (change log)
DescriptionTribolium castaneum miR-3836h stem-loop
Stem-loop
   ---      u          au     uuua 
5'    ggucua ccuugcuuag  ugaua    u
      |||||| ||||||||||  |||||     
3'    ccagau ggaacggguc  acugu    u
   auc      -          --     uauu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG2: 1347667-1347724 [+]
intergenic
Clustered miRNAs
< 10kb from tca-mir-3836h
tca-mir-3836hChLG2: 1347667-1347724 [+]
tca-mir-11639ChLG2: 1348633-1348691 [+]
tca-mir-11617cChLG2: 1355378-1355472 [-]
tca-mir-11619dChLG2: 1355663-1355755 [-]
tca-mir-3836c-1ChLG2: 1355772-1355863 [-]
Database links

Mature sequence tca-miR-3836h-3p

Accession MIMAT0045596
Sequence

37 - 

ucacugggcaagguagacccu

 - 57

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26518483 "MicroRNA evolution, expression, and function during short germband development in Tribolium castaneum" Ninova M, Ronshaugen M, Griffiths-Jones S Genome Res. 26:85-96(2016).