Stem-loop sequence tca-mir-11634

AccessionMI0037429 (change log)
DescriptionTribolium castaneum miR-11634 stem-loop
Stem-loop
   ---a   g    u a          guga  ugca 
5'     uug gagu c gggcgcggcu    cc    g
       ||| |||| | ||||||||||    ||    c
3'     agc cuca g cccgcgccgg    gg    c
   cugg   g    c c          -aga  cuca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG8: 12388730-12388798 [+]
intergenic
Database links

Mature sequence tca-miR-11634-5p

Accession MIMAT0045588
Sequence

1 - 

auugggaguucagggcgcggcu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence tca-miR-11634-3p

Accession MIMAT0045589
Sequence

47 - 

ccgcgccccgcacucgcgaggu

 - 68

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26518483 "MicroRNA evolution, expression, and function during short germband development in Tribolium castaneum" Ninova M, Ronshaugen M, Griffiths-Jones S Genome Res. 26:85-96(2016).