Stem-loop sequence tca-mir-3836g-1

AccessionMI0037425 (change log)
DescriptionTribolium castaneum miR-3836g-1 stem-loop
Stem-loop
   uuuuu      u    ca         c      a  u    uuua 
5'      gaaaug cugu  ggucuaccu ugcuua gu gaua    u
        |||||| ||||  ||||||||| |||||| || ||||     
3'      cuuugc gaca  ucagaugga acgggu ca cuau    u
   aacuu      c    uc         -      -  -    uaau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
Unmapped58: 8038-8128 [-]
intergenic
Clustered miRNAs
< 10kb from tca-mir-3836g-1
tca-mir-3851m-3Unmapped58: 12024-12117 [-]
tca-mir-11618a-3Unmapped58: 11866-11958 [-]
tca-mir-11618b-3Unmapped58: 11468-11562 [-]
tca-mir-3851k-3Unmapped58: 11048-11139 [-]
tca-mir-11617d-2Unmapped58: 9815-9874 [-]
tca-mir-3836g-1Unmapped58: 8038-8128 [-]
tca-mir-11619a-1Unmapped58: 7927-8013 [-]
tca-mir-11617a-3Unmapped58: 7787-7879 [-]
Database links

Mature sequence tca-miR-3836g-5p

Accession MIMAT0045583
Sequence

18 - 

aggucuaccucugcuuaaguugaua

 - 42

Get sequence
Evidence experimental; Illumina [1]

Mature sequence tca-miR-3836g-3p

Accession MIMAT0045584
Sequence

55 - 

ucacugggcaagguagacucu

 - 75

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26518483 "MicroRNA evolution, expression, and function during short germband development in Tribolium castaneum" Ninova M, Ronshaugen M, Griffiths-Jones S Genome Res. 26:85-96(2016).