Stem-loop sequence tca-mir-11632

AccessionMI0037423 (change log)
DescriptionTribolium castaneum miR-11632 stem-loop
Stem-loop
   aauuc   -aa  a   uau         uuagu         aauaagg  c   ------     uuu   a      a   caa 
5'      ucu   ac ugc   acuuugauu     aaggauuuu       uu ccc      gcagg   uuu auaaau acu   a
        |||   || |||   |||||||||     |||||||||       || |||      |||||   ||| |||||| |||    
3'      aga   ug gcg   ugaaacuaa     uuuuugaaa       aa ggg      ugucc   aga uauuug uga   a
   ---au   aag  -   uuu         ccaau         -------  u   uacugu     ccc   c      g   auu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG6: 8740458-8740615 [+]
intergenic
Database links

Mature sequence tca-miR-11632-5p

Accession MIMAT0045579
Sequence

30 - 

uaguaaggauuuuaauaagguuccccgc

 - 57

Get sequence
Evidence experimental; Illumina [1]

Mature sequence tca-miR-11632-3p

Accession MIMAT0045580
Sequence

105 - 

uguugucauggguaaaaaguuuuuuaacc

 - 133

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26518483 "MicroRNA evolution, expression, and function during short germband development in Tribolium castaneum" Ninova M, Ronshaugen M, Griffiths-Jones S Genome Res. 26:85-96(2016).