Stem-loop sequence tca-mir-3858b

AccessionMI0037422 (change log)
DescriptionTribolium castaneum miR-3858b stem-loop
Stem-loop
   acac       uguuu          -     uu       g gu 
5'     aguuugu     uuagagaagc gaaga  uuucguu u  a
       |||||||     |||||||||| |||||  ||||||| |  a
3'     uuaaacg     aaucucuucg uuucu  aaaguaa a  a
   uuau       uaaau          a     -c       g aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG6: 272928-273018 [-]
intergenic
Clustered miRNAs
< 10kb from tca-mir-3858b
tca-mir-11626aChLG6: 273458-273621 [-]
tca-mir-11625aChLG6: 273252-273366 [-]
tca-mir-3851jChLG6: 273130-273224 [-]
tca-mir-3851iChLG6: 273027-273118 [-]
tca-mir-3858bChLG6: 272928-273018 [-]
tca-mir-11642ChLG6: 272831-272890 [-]
Database links

Mature sequence tca-miR-3858b-5p

Accession MIMAT0045577
Sequence

19 - 

agagaagcgaagauuuuucguu

 - 40

Get sequence
Evidence experimental; Illumina [1]

Mature sequence tca-miR-3858b-3p

Accession MIMAT0045578
Sequence

54 - 

ugaaacucuuuagcuucucuaa

 - 75

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26518483 "MicroRNA evolution, expression, and function during short germband development in Tribolium castaneum" Ninova M, Ronshaugen M, Griffiths-Jones S Genome Res. 26:85-96(2016).