Stem-loop sequence tca-mir-11631

AccessionMI0037419 (change log)
DescriptionTribolium castaneum miR-11631 stem-loop
Stem-loop
   ggcaa  - ga   gg  ug     ug     g       a   a agc 
5'      ug g  ggg  au  gcagc  gaguu acucuug ugg c   c
        || |  |||  ||  |||||  ||||| ||||||| ||| |    
3'      ac c  ccc  ua  ugucg  uucag ugggaac acc g   c
   uuaua  a ug   uu  gu     ua     g       c   a auc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG5: 14715761-14715859 [+]
intergenic
Database links

Mature sequence tca-miR-11631-5p

Accession MIMAT0045572
Sequence

18 - 

uggcagcuggaguugacucuuga

 - 40

Get sequence
Evidence experimental; Illumina [1]

Mature sequence tca-miR-11631-3p

Accession MIMAT0045573
Sequence

58 - 

accaaggguggacuuaugcugu

 - 79

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26518483 "MicroRNA evolution, expression, and function during short germband development in Tribolium castaneum" Ninova M, Ronshaugen M, Griffiths-Jones S Genome Res. 26:85-96(2016).