Stem-loop sequence tca-mir-11618a-2

AccessionMI0037412 (change log)
DescriptionTribolium castaneum miR-11618a-2 stem-loop
Stem-loop
   acaaa    -u     u   u   u           uuuc    c  u 
5'      augu  uucga gua agu agcauuggucg    uaug uu u
        ||||  ||||| ||| ||| |||||||||||    |||| || u
3'      uaca  aagcu uau ucg ucguagcuagc    auac ag a
   gucaa    cu     u   u   c           -cau    u  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
Unmapped66: 4367-4463 [-]
intergenic
Clustered miRNAs
< 10kb from tca-mir-11618a-2
tca-mir-3851m-4Unmapped66: 13133-13208 [-]
tca-mir-3851l-4Unmapped66: 8276-8336 [-]
tca-mir-3851rUnmapped66: 4524-4597 [-]
tca-mir-11618a-2Unmapped66: 4367-4463 [-]
tca-mir-3836c-5Unmapped66: 4155-4215 [-]
Database links

Mature sequence tca-miR-11618a-5p

Accession MIMAT0045489
Sequence

21 - 

aguuagcauuggucguuucuaug

 - 43

Get sequence
Evidence experimental; Illumina [1]

Mature sequence tca-miR-11618a-3p

Accession MIMAT0045490
Sequence

57 - 

uauaccgaucgaugcucgcuuu

 - 78

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26518483 "MicroRNA evolution, expression, and function during short germband development in Tribolium castaneum" Ninova M, Ronshaugen M, Griffiths-Jones S Genome Res. 26:85-96(2016).