Stem-loop sequence tca-mir-11618b-3

AccessionMI0037402 (change log)
DescriptionTribolium castaneum miR-11618b-3 stem-loop
Stem-loop
   caaaa  uu     u   -u   u            uu     -   a 
5'      ug  uucga acu  agu agcauuggcugu  cuaug cua u
        ||  ||||| |||  ||| ||||||||||||  ||||| ||| u
3'      ac  aggcu uga  ucg uuguaaccgaca  gauac ggu u
   caaua  uu     -   cu   u            -u     u   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
Unmapped58: 11468-11562 [-]
intergenic
Clustered miRNAs
< 10kb from tca-mir-11618b-3
tca-mir-3851m-3Unmapped58: 12024-12117 [-]
tca-mir-11618a-3Unmapped58: 11866-11958 [-]
tca-mir-11618b-3Unmapped58: 11468-11562 [-]
tca-mir-3851k-3Unmapped58: 11048-11139 [-]
tca-mir-11617d-2Unmapped58: 9815-9874 [-]
tca-mir-3836g-1Unmapped58: 8038-8128 [-]
tca-mir-11619a-1Unmapped58: 7927-8013 [-]
tca-mir-11617a-3Unmapped58: 7787-7879 [-]
Database links

Mature sequence tca-miR-11618b-5p

Accession MIMAT0045495
Sequence

20 - 

aguuagcauuggcuguuucuaug

 - 42

Get sequence
Evidence experimental; Illumina [1]

Mature sequence tca-miR-11618b-3-3p

Accession MIMAT0045555
Sequence

57 - 

uaguacagccaauguuugcuuc

 - 78

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26518483 "MicroRNA evolution, expression, and function during short germband development in Tribolium castaneum" Ninova M, Ronshaugen M, Griffiths-Jones S Genome Res. 26:85-96(2016).