Stem-loop sequence tca-mir-3851k-3

AccessionMI0037401 (change log)
DescriptionTribolium castaneum miR-3851k-3 stem-loop
Stem-loop
   gaaua      g             aaa   g    c   uaaca 
5'      aauuua ugcuggguuggca   ggu guac aug     u
        |||||| |||||||||||||   ||| |||| |||     u
3'      uuaaau augacucggccgu   cca caug uac     u
   uaaca      a             -ac   g    a   ccaau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
Unmapped58: 11048-11139 [-]
intergenic
Clustered miRNAs
< 10kb from tca-mir-3851k-3
tca-mir-3851m-3Unmapped58: 12024-12117 [-]
tca-mir-11618a-3Unmapped58: 11866-11958 [-]
tca-mir-11618b-3Unmapped58: 11468-11562 [-]
tca-mir-3851k-3Unmapped58: 11048-11139 [-]
tca-mir-11617d-2Unmapped58: 9815-9874 [-]
tca-mir-3836g-1Unmapped58: 8038-8128 [-]
tca-mir-11619a-1Unmapped58: 7927-8013 [-]
tca-mir-11617a-3Unmapped58: 7787-7879 [-]
Database links

Mature sequence tca-miR-3851k-5p

Accession MIMAT0045493
Sequence

18 - 

gguuggcaaaaggugguaccaug

 - 40

Get sequence
Evidence experimental; Illumina [1]

Mature sequence tca-miR-3851k-3p

Accession MIMAT0045494
Sequence

56 - 

uaguacgacccaugccggcuca

 - 77

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26518483 "MicroRNA evolution, expression, and function during short germband development in Tribolium castaneum" Ninova M, Ronshaugen M, Griffiths-Jones S Genome Res. 26:85-96(2016).