Stem-loop sequence tca-mir-11628

AccessionMI0037396 (change log)
DescriptionTribolium castaneum miR-11628 stem-loop
Stem-loop
   gcauc          g   aau                   -   ugu 
5'      aaaauaaggc uga   ugcaggaacucuacuuacg uaa   u
        |||||||||| |||   ||||||||||||||||||| |||   u
3'      uuuuauuuug acu   acguucuugagaugagugc auu   a
   aauuu          -   --g                   u   uua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG9: 10582062-10582156 [-]
intergenic
Clustered miRNAs
< 10kb from tca-mir-11628
tca-mir-275ChLG9: 10587608-10587678 [-]
tca-mir-305ChLG9: 10587469-10587543 [-]
tca-mir-11628ChLG9: 10582062-10582156 [-]
Database links

Mature sequence tca-miR-11628-5p

Accession MIMAT0045548
Sequence

4 - 

ucaaaauaaggcgugaaauugcaggaacuc

 - 33

Get sequence
Evidence experimental; Illumina [1]

Mature sequence tca-miR-11628-3p

Accession MIMAT0045549
Sequence

60 - 

ugaguagaguucuugcagucagu

 - 82

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26518483 "MicroRNA evolution, expression, and function during short germband development in Tribolium castaneum" Ninova M, Ronshaugen M, Griffiths-Jones S Genome Res. 26:85-96(2016).