Stem-loop sequence tca-mir-11627

AccessionMI0037395 (change log)
DescriptionTribolium castaneum miR-11627 stem-loop
Stem-loop
   agugu    gauu    ---      uuc  ac     -     uguu 
5'      aggc    uuga   cccauc   ag  aacuc uggau    u
        ||||    ||||   ||||||   ||  ||||| |||||     
3'      ucug    aacu   ggguag   uc  uugag accug    u
   gauuu    --au    aga      uuu  gu     c     uaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG7: 11855707-11855798 [-]
intergenic
Clustered miRNAs
< 10kb from tca-mir-11627
tca-mir-11627ChLG7: 11855707-11855798 [-]
tca-mir-3859ChLG7: 11854759-11854827 [-]
Database links

Mature sequence tca-miR-11627-5p

Accession MIMAT0045546
Sequence

17 - 

acccaucuucagacaacucugg

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence tca-miR-11627-3p

Accession MIMAT0045547
Sequence

56 - 

cgaguuugcuuuugaugggaga

 - 77

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26518483 "MicroRNA evolution, expression, and function during short germband development in Tribolium castaneum" Ninova M, Ronshaugen M, Griffiths-Jones S Genome Res. 26:85-96(2016).