Stem-loop sequence tca-mir-11624c

AccessionMI0037394 (change log)
DescriptionTribolium castaneum miR-11624c stem-loop
Stem-loop
   uaaua     g    a      g          uu     caauu 
5'      gauug ugua aauuga acuuuaguau  ucaug     u
        ||||| |||| |||||| ||||||||||  |||||     a
3'      cuaac acau uuggcu ugaaaucgua  aguac     u
   aaaca     a    c      g          -u     aacug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG6: 8825488-8825579 [+]
intergenic
Clustered miRNAs
< 10kb from tca-mir-11624c
tca-mir-3851d-1ChLG6: 8819480-8819570 [-]
tca-mir-11624b-1ChLG6: 8819743-8819834 [-]
tca-mir-11626bChLG6: 8825341-8825447 [+]
tca-mir-11624cChLG6: 8825488-8825579 [+]
tca-mir-3851cChLG6: 8825723-8825833 [+]
tca-mir-3851g-3ChLG6: 8825859-8825916 [+]
Database links

Mature sequence tca-miR-11624c-5p

Accession MIMAT0045544
Sequence

18 - 

auugagacuuuaguauuuucaug

 - 40

Get sequence
Evidence experimental; Illumina [1]

Mature sequence tca-miR-11624c-3p

Accession MIMAT0045545
Sequence

56 - 

ugauaugcuaaagugucgguu

 - 76

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26518483 "MicroRNA evolution, expression, and function during short germband development in Tribolium castaneum" Ninova M, Ronshaugen M, Griffiths-Jones S Genome Res. 26:85-96(2016).