Stem-loop sequence tca-mir-11626b

AccessionMI0037393 (change log)
DescriptionTribolium castaneum miR-11626b stem-loop
Stem-loop
   aauuu           g g   a      uu          uc ca     ca 
5'      ugguuuuguuu u ggc ugauug  uuagcucaug  u  ugauu  u
        ||||||||||| | ||| ||||||  ||||||||||  |  |||||   
3'      accaagacaaa g ccg acuaac  aguugaguac  a  guuag  g
   cuucc           g a   g      -u          ga ag     ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG6: 8825341-8825447 [+]
intergenic
Clustered miRNAs
< 10kb from tca-mir-11626b
tca-mir-3851d-1ChLG6: 8819480-8819570 [-]
tca-mir-11624b-1ChLG6: 8819743-8819834 [-]
tca-mir-11626bChLG6: 8825341-8825447 [+]
tca-mir-11624cChLG6: 8825488-8825579 [+]
tca-mir-3851cChLG6: 8825723-8825833 [+]
tca-mir-3851g-3ChLG6: 8825859-8825916 [+]
Database links

Mature sequence tca-miR-11626b-5p

Accession MIMAT0045542
Sequence

20 - 

ggcaugauuguuuuagcucaug

 - 41

Get sequence
Evidence experimental; Illumina [1]

Mature sequence tca-miR-11626b-3p

Accession MIMAT0045543
Sequence

70 - 

ugaguugaucaaucaggccagg

 - 91

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26518483 "MicroRNA evolution, expression, and function during short germband development in Tribolium castaneum" Ninova M, Ronshaugen M, Griffiths-Jones S Genome Res. 26:85-96(2016).