Stem-loop sequence tca-mir-11625a

AccessionMI0037391 (change log)
DescriptionTribolium castaneum miR-11625a stem-loop
Stem-loop
   auuaa   acuug        u   u   a  u      g  ug    uuc     ca 
5'      cca     auucaaaa uga uuu ag agacau ag  gugu   ugugg  u
        |||     |||||||| ||| ||| || |||||| ||  ||||   |||||   
3'      ggu     uaaguuuu gcu aga uc ucugua uc  caua   auacu  u
   cauaa   ccuca        c   c   g  c      a  gu    ---     ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG6: 273252-273366 [-]
intergenic
Clustered miRNAs
< 10kb from tca-mir-11625a
tca-mir-11626aChLG6: 273458-273621 [-]
tca-mir-11625aChLG6: 273252-273366 [-]
tca-mir-3851jChLG6: 273130-273224 [-]
tca-mir-3851iChLG6: 273027-273118 [-]
tca-mir-3858bChLG6: 272928-273018 [-]
tca-mir-11642ChLG6: 272831-272890 [-]
Database links

Mature sequence tca-miR-11625a-5p

Accession MIMAT0045538
Sequence

30 - 

aaguagacaugagugguguuucu

 - 52

Get sequence
Evidence experimental; Illumina [1]

Mature sequence tca-miR-11625a-3p

Accession MIMAT0045539
Sequence

66 - 

uaauacugcuaaugucuccugag

 - 88

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26518483 "MicroRNA evolution, expression, and function during short germband development in Tribolium castaneum" Ninova M, Ronshaugen M, Griffiths-Jones S Genome Res. 26:85-96(2016).