Stem-loop sequence tca-mir-3851h

AccessionMI0037387 (change log)
DescriptionTribolium castaneum miR-3851h stem-loop
Stem-loop
   aauua      a        g         g        uaauu 
5'      aauuua uauugagu gacaugggu guacugug     u
        |||||| |||||||| ||||||||| ||||||||      
3'      uuaaau augacucg uuguaccug caugauac     u
   uuaca      a        g         g        ucagu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG6: 8929175-8929264 [-]
intergenic
Clustered miRNAs
< 10kb from tca-mir-3851h
tca-mir-11624dChLG6: 8930530-8930621 [-]
tca-mir-3851eChLG6: 8930351-8930445 [-]
tca-mir-3851d-2ChLG6: 8930246-8930336 [-]
tca-mir-3858a-2ChLG6: 8930130-8930244 [-]
tca-mir-11624b-2ChLG6: 8929472-8929532 [-]
tca-mir-3851fChLG6: 8929279-8929373 [-]
tca-mir-3851hChLG6: 8929175-8929264 [-]
tca-mir-3858ChLG6: 8929084-8929152 [-]
Database links

Mature sequence tca-miR-3851h-5p

Accession MIMAT0045530
Sequence

18 - 

aguggacaugggugguacuguguaa

 - 42

Get sequence
Evidence experimental; Illumina [1]

Mature sequence tca-miR-3851h-3p

Accession MIMAT0045531
Sequence

54 - 

uaguacgguccauguuggcuca

 - 75

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26518483 "MicroRNA evolution, expression, and function during short germband development in Tribolium castaneum" Ninova M, Ronshaugen M, Griffiths-Jones S Genome Res. 26:85-96(2016).