Stem-loop sequence tca-mir-309c

AccessionMI0037385 (change log)
DescriptionTribolium castaneum miR-309c stem-loop
Literature search

2 open access papers mention tca-mir-309c
(15 sentences)

Stem-loop
   auucc    cc   u          ca        u     auu 
5'      ggua  acu uuggauaaac  uacucagu gaugu   a
        ||||  ||| ||||||||||  |||||||| |||||    
3'      ccau  uga aaccuguuug  auggguca cuacg   u
   aacca    uu   u          ag        -     aaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG5: 7175649-7175737 [+]
intergenic
Clustered miRNAs
< 10kb from tca-mir-309c
tca-mir-9dChLG5: 7174040-7174132 [+]
tca-mir-2944bChLG5: 7174149-7174250 [+]
tca-mir-309aChLG5: 7174273-7174360 [+]
tca-mir-3893ChLG5: 7175554-7175633 [+]
tca-mir-309cChLG5: 7175649-7175737 [+]
tca-mir-309bChLG5: 7175766-7175855 [+]
tca-mir-3791ChLG5: 7175867-7175951 [+]
Database links

Mature sequence tca-miR-309c-5p

Accession MIMAT0045526
Sequence

18 - 

ggauaaaccauacucaguugaug

 - 40

Get sequence
Evidence experimental; Illumina [1]

Mature sequence tca-miR-309c-3p

Accession MIMAT0045527
Sequence

53 - 

ucacuggguagaguuuguccaa

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26518483 "MicroRNA evolution, expression, and function during short germband development in Tribolium castaneum" Ninova M, Ronshaugen M, Griffiths-Jones S Genome Res. 26:85-96(2016).