Stem-loop sequence tca-mir-11624a-1

AccessionMI0037382 (change log)
DescriptionTribolium castaneum miR-11624a-1 stem-loop
Stem-loop
   uaaua    ag    a      g      a   uu     caauu 
5'      gaua  ugua aauuga acuuua cau  ucaug     u
        ||||  |||| |||||| |||||| |||  |||||     a
3'      cuau  acau uuggcu ugagau gua  aguac     u
   aaaca    ca    c      g      c   -u     aacua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG5: 209129-209220 [-]
intergenic
Clustered miRNAs
< 10kb from tca-mir-11624a-1
tca-mir-11624a-1ChLG5: 209129-209220 [-]
tca-mir-11625bChLG5: 209017-209114 [-]
tca-mir-3851a-2ChLG5: 208878-208985 [-]
tca-mir-3851g-1ChLG5: 208780-208870 [-]
Database links

Mature sequence tca-miR-11624a-5p

Accession MIMAT0045523
Sequence

18 - 

auugagacuuuaacauuuucaug

 - 40

Get sequence
Evidence experimental; Illumina [1]

Mature sequence tca-miR-11624a-3p

Accession MIMAT0045524
Sequence

56 - 

ugauaugcuagagugucgguucu

 - 78

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26518483 "MicroRNA evolution, expression, and function during short germband development in Tribolium castaneum" Ninova M, Ronshaugen M, Griffiths-Jones S Genome Res. 26:85-96(2016).