Stem-loop sequence tca-mir-11623

AccessionMI0037380 (change log)
DescriptionTribolium castaneum miR-11623 stem-loop
Stem-loop
   acac        --  -a     a        gg 
5'     ucgcgucc  ga  cgauc cggcggag  u
       ||||||||  ||  ||||| ||||||||   
3'     ggugcagg  cu  gcuag gccgcuuu  u
   agca        ua  cg     -        ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG5: 11212467-11212532 [-]
intergenic
Database links

Mature sequence tca-miR-11623-5p

Accession MIMAT0045519
Sequence

3 - 

acucgcguccgaacgaucacggcg

 - 26

Get sequence
Evidence experimental; Illumina [1]

Mature sequence tca-miR-11623-3p

Accession MIMAT0045520
Sequence

41 - 

ccggaucggcucauggacguggac

 - 64

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26518483 "MicroRNA evolution, expression, and function during short germband development in Tribolium castaneum" Ninova M, Ronshaugen M, Griffiths-Jones S Genome Res. 26:85-96(2016).