Stem-loop sequence tca-mir-11622

AccessionMI0037379 (change log)
DescriptionTribolium castaneum miR-11622 stem-loop
Stem-loop
   acuaa      u   g          -               c 
5'      aucagu gau uaaaggaauu gcaggauugaaaugu u
        |||||| ||| |||||||||| ||||||||||||||| g
3'      uaguca uug guuuccuuaa uguucugauuuugcg c
   aaaaa      u   g          a               a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG3: 1732366-1732453 [-]
intergenic
Database links

Mature sequence tca-miR-11622-5p

Accession MIMAT0045517
Sequence

17 - 

uaaaggaauugcaggauugaaa

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence tca-miR-11622-3p

Accession MIMAT0045518
Sequence

52 - 

uuagucuuguaaauuccuuuggg

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26518483 "MicroRNA evolution, expression, and function during short germband development in Tribolium castaneum" Ninova M, Ronshaugen M, Griffiths-Jones S Genome Res. 26:85-96(2016).