Stem-loop sequence tca-mir-3851o-2

AccessionMI0037361 (change log)
DescriptionTribolium castaneum miR-3851o-2 stem-loop
Stem-loop
   uauua      g    u      c    a  g    c   uaaaa 
5'      aauuua ugcu gguugg gugg gu guac aug     u
        |||||| |||| |||||| |||| || |||| |||     u
3'      uuaaau auga ccggcc uacc ca caug uac     u
   uaaaa      a    c      u    -  g    a   cuaau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG2: 2688436-2688527 [+]
intergenic
Clustered miRNAs
< 10kb from tca-mir-3851o-2
tca-mir-11619fChLG2: 2681738-2681831 [+]
tca-mir-3836fChLG2: 2682284-2682360 [+]
tca-mir-11618b-2ChLG2: 2682829-2682923 [+]
tca-mir-3851l-2ChLG2: 2683248-2683339 [+]
tca-mir-3836i-1ChLG2: 2683595-2683654 [+]
tca-mir-11617f-2ChLG2: 2684205-2684263 [+]
tca-mir-3851o-1ChLG2: 2684529-2684620 [+]
tca-mir-3851qChLG2: 2684812-2684919 [+]
tca-mir-11618a-4ChLG2: 2684982-2685066 [+]
tca-mir-3836c-3ChLG2: 2685740-2685831 [+]
tca-mir-11619eChLG2: 2685848-2685949 [+]
tca-mir-3836eChLG2: 2686164-2686240 [+]
tca-mir-11618b-1ChLG2: 2686697-2686791 [+]
tca-mir-3851k-1ChLG2: 2687120-2687211 [+]
tca-mir-3836i-2ChLG2: 2687488-2687547 [+]
tca-mir-11617f-1ChLG2: 2688112-2688170 [+]
tca-mir-3851o-2ChLG2: 2688436-2688527 [+]
tca-mir-11618a-1ChLG2: 2688893-2688985 [+]
tca-mir-3836c-2ChLG2: 2689646-2689737 [+]
tca-mir-3836dChLG2: 2691160-2691250 [+]
tca-mir-3836bChLG2: 2692194-2692284 [+]
tca-mir-11617a-1ChLG2: 2692443-2692535 [+]
Database links

Mature sequence tca-miR-3851o-2-5p

Accession MIMAT0045491
Sequence

18 - 

gguuggcguggagugguaccaug

 - 40

Get sequence
Evidence experimental; Illumina [1]

Mature sequence tca-miR-3851o-3p

Accession MIMAT0045492
Sequence

56 - 

uaguacgacccauuccggccca

 - 77

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26518483 "MicroRNA evolution, expression, and function during short germband development in Tribolium castaneum" Ninova M, Ronshaugen M, Griffiths-Jones S Genome Res. 26:85-96(2016).