Stem-loop sequence bdo-mir-210

AccessionMI0037309 (change log)
DescriptionBactrocera dorsalis miR-210 stem-loop
Stem-loop
   --        gc   -         -   g 
5'   agcugcug  cac ugcacaaga uua a
     ||||||||  ||| ||||||||| ||| u
3'   ucggcgac  gug gcguguucu agu u
   ua        -a   u         c   a 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM78921v2; GCA_000789215.2) Overlapping transcripts
scaffold00084: 612926-612983 [-]
intergenic
Database links

Mature sequence bdo-miR-210

Accession MIMAT0045431
Sequence

37 - 

uugugcgugugacagcggcuau

 - 58

Get sequence
Evidence experimental; Torrent [1]

References

1