Stem-loop sequence bdo-mir-308

AccessionMI0037303 (change log)
DescriptionBactrocera dorsalis miR-308 stem-loop
Literature search

1 open access papers mention bdo-mir-308
(3 sentences)

Stem-loop
   --         u       u    --   a 
5'   cgcaguaua uuuugug uaug  ugu c
     ||||||||| ||||||| ||||  ||| u
3'   gugucauau aggacac auac  aca u
   ga         u       u    ua   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM78921v2; GCA_000789215.2) Overlapping transcripts
scaffold00075: 955990-956048 [+]
intergenic
Database links

Mature sequence bdo-miR-308

Accession MIMAT0045426
Sequence

1 - 

cgcaguauauuuuuguguuaug

 - 22

Get sequence
Evidence experimental; Torrent [1]

References

1