Stem-loop sequence cas-MIR396b

AccessionMI0037225 (change log)
DescriptionCamelina sativa miR396b stem-loop
Literature search

1 open access papers mention cas-MIR396b
(2 sentences)

Stem-loop
   u                   a       --        uuuccuuuuaaccaaua      aaca 
5'  uuuuccacagcuuucuuga cuuuuuu  uguuuuca                 uagcua    a
    ||||||||||||||||||| |||||||  ||||||||                 ||||||    a
3'  aaagggugucgaaagaacu gaaaaag  acaaaggu                 auugau    a
   a                   c       aa        -----------uuuacg      cucu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cs; GCA_000633955.1) Overlapping transcripts
chr10: 18158326-18158445 [+]
intergenic
Database links

Mature sequence cas-miR396b

Accession MIMAT0045347
Sequence

4 - 

uuccacagcuuucuugaacuu

 - 24

Get sequence
Evidence experimental; Illumina [1]

References

1