Stem-loop sequence gmo-mir-11240

AccessionMI0036298 (change log)
DescriptionGadus morhua miR-11240 stem-loop
Stem-loop
   -gc      ga     g  ga   a a  gugac 
5'    ggguuc  uuccc cu  ccg g cu     u
      ||||||  ||||| ||  ||| | ||      
3'    cuuagg  gaggg gg  ggc c ga     u
   ggu      -a     a  ag   c c  aauaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GadMor_May2010; GCA_000231765.1) Overlapping transcripts
HE571035.1: 65483-65550 [+]
intergenic
Database links

Mature sequence gmo-miR-11240-5p

Accession MIMAT0044417
Sequence

1 - 

gcggguucgauucccgcuga

 - 20

Get sequence
Evidence experimental; SOLiD [1]

References

1
PMID:25881242 "Temperature during early development has long-term effects on microRNA expression in Atlantic cod" Bizuayehu TT, Johansen SD, Puvanendran V, Toften H, Babiak I BMC Genomics. 16:305(2015).