Stem-loop sequence gmo-mir-11183

AccessionMI0036090 (change log)
DescriptionGadus morhua miR-11183 stem-loop
Stem-loop
   --               g      c  c 
5'   ggccccagguagagc ccuuca cg g
     ||||||||||||||| |||||| ||  
3'   ccgggguccaucucg ggaagu gc g
   ac               a      c  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GadMor_May2010; GCA_000231765.1) Overlapping transcripts
HE567111.1: 1660946-1661001 [-]
intergenic
Database links

Mature sequence gmo-miR-11183-5p

Accession MIMAT0044169
Sequence

3 - 

ccccagguagagcgccuucacc

 - 24

Get sequence
Evidence experimental; Illumina [2]

Mature sequence gmo-miR-11183-3p

Accession MIMAT0044170
Sequence

35 - 

aaggagcucuaccuggggccca

 - 56

Get sequence
Evidence experimental; SOLiD [1], Illumina [2]

References

1
PMID:25881242 "Temperature during early development has long-term effects on microRNA expression in Atlantic cod" Bizuayehu TT, Johansen SD, Puvanendran V, Toften H, Babiak I BMC Genomics. 16:305(2015).
2